View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16552_high_18 (Length: 238)

Name: NF16552_high_18
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16552_high_18
NF16552_high_18
[»] chr8 (2 HSPs)
chr8 (18-238)||(2368748-2368968)
chr8 (105-195)||(2365416-2365506)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 2368748 - 2368968
Alignment:
18 gatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggatctggtataggagg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2368748 gatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggatctggtataggagg 2368847  T
118 attgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatggttatggttatggacatgggaag 217  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||    
2368848 attgatcgcaggggcggcagctgcatatggtgctcaccatctgtctcatggacatggaggttaccatcatggttatggttatggttatggacatgggaag 2368947  T
218 tataagcatggcaaatttggc 238  Q
    |||||||||||||||||||||    
2368948 tataagcatggcaaatttggc 2368968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 195
Target Start/End: Original strand, 2365416 - 2365506
Alignment:
105 ctggtataggaggattgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatgg 195  Q
    |||||||||||||| || | ||||| | ||  |||||||||||| |||||||||||||  |||||||||||||||||||||||||| ||||    
2365416 ctggtataggaggactgtttgcaggaggggtggctgcatacggttctcaccatctgtcacatggacatggaggttatcatcatggtcatgg 2365506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University