View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_high_20 (Length: 207)
Name: NF16552_high_20
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 38358124 - 38357951
Alignment:
| Q |
15 |
aagaatgatggcagatcatgctatggtgaggaaactttcagcttgtgaaactatgggatcagcaacagttatctgcactgataaaacaggtaccttgaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38358124 |
aagaatgatggcagatcatgctatggtgaggaaactttcagcttgtgaaactatgggatcagcaacagttatctgcactgataaaacaggtaccttgaca |
38358025 |
T |
|
| Q |
115 |
ttgaatcaaatgagggtgaccaagttttgtcttggtcctgaaaatattatggaaaatttttccaatgcaatgac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38358024 |
ttgaatcaaatgagggtgaccaagttttgtcttggtcctgaaaatattatagaaaatttttccaatgcaatgac |
38357951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 4243450 - 4243361
Alignment:
| Q |
18 |
aatgatggcagatcatgctatggtgaggaaactttcagcttgtgaaactatgggatcagcaacagttatctgcactgataaaacaggtac |
107 |
Q |
| |
|
||||||||| ||||| || |||||||| |||||||| || |||||||||||||||||||| || ||| ||||||||||| |||||||| |
|
|
| T |
4243450 |
aatgatggctgatcaagcaatggtgagaaaactttctgcatgtgaaactatgggatcagctactactatttgcactgataagacaggtac |
4243361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 81
Target Start/End: Complemental strand, 39951640 - 39951612
Alignment:
| Q |
53 |
cagcttgtgaaactatgggatcagcaaca |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39951640 |
cagcttgtgaaactatgggatcagcaaca |
39951612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University