View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_high_4 (Length: 408)
Name: NF16552_high_4
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 7e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 41864222 - 41864438
Alignment:
| Q |
1 |
ttatgttaagttttattattgatgcacaaatttgaagttcaagtttattttctcatgtattgtgctcaatttgattcctaacactttgttttatgtgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41864222 |
ttatgttaagttttattattgatgcacaaatttgaagttcaagtttattttctcatgtattgtgctcaatttgattcctaacactttgttttatgtgtgt |
41864321 |
T |
|
| Q |
101 |
atgatgcagtactacaattaaggagcaattttactgcataataaataaattggagtttgaagatcggagtttgcaactcaaagcccaatataatgtatgt |
200 |
Q |
| |
|
||| ||| |||| |||||||||||| ||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41864322 |
atgcagcactactgcaattaaggagccattgtactacataataaataaattggagattgaagatcggagtttgcaactcaaagtccaatataatgtatgt |
41864421 |
T |
|
| Q |
201 |
ggtgattgttggcctgt |
217 |
Q |
| |
|
| ||||| ||||||||| |
|
|
| T |
41864422 |
gatgattattggcctgt |
41864438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University