View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_11 (Length: 328)
Name: NF16552_low_11
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 99 - 314
Target Start/End: Complemental strand, 37866455 - 37866239
Alignment:
| Q |
99 |
cgagtagtaaaagttaaatcatctgtaacnnnnnnncnnnnnnnaacataaaaagttttatttgtcaatttaattaccacaatgtcaaccattagtcatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37866455 |
cgagtagtaaaagttaaatcatctgtaacaaaaaaactttttttaacataaaaagttttatttgtcaatttaattaccacaatgtcaaccattagtcatt |
37866356 |
T |
|
| Q |
199 |
gtaatgattgtttttattatgtcattctttaagtgaatcgaatgactt-ttttcacaattgtcaacttaattcttaatcctaaactacaaacactaccac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37866355 |
gtaatgattgtttttattatgtcattctttaagtgaatcgaatgactttttttcacaattttcaacttaattcttaatcctaaactacaaacactactac |
37866256 |
T |
|
| Q |
298 |
tagtactatatttttat |
314 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37866255 |
tagtactatatttttat |
37866239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University