View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_13 (Length: 306)
Name: NF16552_low_13
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 98 - 296
Target Start/End: Complemental strand, 2646187 - 2645986
Alignment:
| Q |
98 |
ttgtcacataatcttcaatcatgttatctactagagtgctctataatgtcaacctcacaacttgctttgtagttttcatagaagttaatccataacttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
2646187 |
ttgtcacataatcttcaatcatgttatctactagagtgctctataatgtcaacctcacaacttgctttgtagttctcaaagaagttaatccgtaacttca |
2646088 |
T |
|
| Q |
198 |
attattttttatatttgttcatatcttataataagaagactactagctagaaatctagttactacctactatcattcacaaa---ttgtgcattagaata |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2646087 |
attattttttatatttgttcatatcttataataagaagacttctagctagaaatctagttactacctactatcattcacaaactcttgcgcattagaata |
2645988 |
T |
|
| Q |
295 |
at |
296 |
Q |
| |
|
|| |
|
|
| T |
2645987 |
at |
2645986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 2646341 - 2646239
Alignment:
| Q |
1 |
ggttagtctttgtgtgttcatttctaatattccccctcatttttctttcactcacatctaatcttccaaaattttctattattcaacaatgttactcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2646341 |
ggttagtctttgtgtgttcatttctaatattccccctcatttttctttcactcacatctaatcttccaaaattttctattattcaacaatgttaatcttg |
2646242 |
T |
|
| Q |
101 |
tca |
103 |
Q |
| |
|
||| |
|
|
| T |
2646241 |
tca |
2646239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University