View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_14 (Length: 280)
Name: NF16552_low_14
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 9 - 260
Target Start/End: Complemental strand, 13000809 - 13000556
Alignment:
| Q |
9 |
ggagcagagacacatacatggatactgatctgtcgacattgataatgattagtgaaaatatcataatttatgtaatcaca--tgtgttggtgttgatcac |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13000809 |
ggagcagagacacatacacggatactgatatgtcgacattgataatgattagtgaaaatatcataatttatgtaatcacaaatgtgttggtgttgatcac |
13000710 |
T |
 |
| Q |
107 |
tgacatgatatgtctttgatcaaaagtgtcggtgttatagagtaattgaatctctaggtttgttattcacttgatgatggaacttttgttacataggtag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13000709 |
tgacatgatatgtctttgatcaaaagtgtcggtgttatagagtaattgaatctctaggtttgttattcacctgatgatggaacttttgttacataggtag |
13000610 |
T |
 |
| Q |
207 |
ttaattcctttgtctttttattaagcatttatagatggataaaaaggttaacta |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13000609 |
ttaattcctttgtctttttattaagcatttatagatggataaaaaggttaacta |
13000556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University