View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_16 (Length: 244)
Name: NF16552_low_16
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 41863308 - 41863526
Alignment:
| Q |
16 |
ggatgtatatataaacttaaccctctaaaactcaattagcaaacaaaacttcagtagcacaatcccaaatgagtcagctgggaacttcttattagggatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863308 |
ggatgtatatataaacttaaccctctaaaactcaattagcaaacaaaaccttagtagcacaatcccaaatgagtcagctgggaacttcttattagggatg |
41863407 |
T |
 |
| Q |
116 |
tctacatatatatgattctcatctctgccaaatttttagaagttcctgaacgaaattaatttggtatatattcattcagtgggcaaaaatgataaaaagg |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41863408 |
tctatatatatatgattctcatctctgccaaatttttagaagttcctgaacgaaattaatttggtatatattcattcagtggacaaaaatgataaaaagg |
41863507 |
T |
 |
| Q |
216 |
tgataacactgtagaataa |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41863508 |
tgataacactgtagaataa |
41863526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University