View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_17 (Length: 242)
Name: NF16552_low_17
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 224
Target Start/End: Original strand, 4418662 - 4418876
Alignment:
| Q |
10 |
agcatagggcaaaaaagatttctaaaatcacaacgacatggatatgctttgattaatagggtactcatatcacaccaaggggggtgtaaatagaaaaatc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4418662 |
agcattgggcaaaaaagatttctaaaatcacaacgacatggatatgctttgattaatagggtactcatatcacaccaaggggggtgtaaatagaaaaatc |
4418761 |
T |
|
| Q |
110 |
tatagtacaactttgttttcaatacatccgttctttcctgttaggtgggtaactagctgtatctcattttggtatccttttctatgaacatttacggact |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4418762 |
tatagtacaactttgttttcaatagatccgttctttcctgttaggtgggtagctagctgtatctcattttggtatccttttctatgaacatttacggact |
4418861 |
T |
|
| Q |
210 |
aattgcagagaaaat |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4418862 |
aattgcagagaaaat |
4418876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University