View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_18 (Length: 242)
Name: NF16552_low_18
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 56 - 228
Target Start/End: Complemental strand, 36561806 - 36561629
Alignment:
| Q |
56 |
tattgtttaccattgatggtgtggaatattaggggaagggaaaaactgtattataagatactattttgagacattattgtgatcatggtttttgatgtct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36561806 |
tattgtttaccattgatggtgtggaatattaggggaagggaaaaactgtattataagatactattttgagacattattgtgatcatggtttttgatgtct |
36561707 |
T |
|
| Q |
156 |
ttacaaccgtgaagcaaccatgcatgat-----atcaaggactgcattagtggtgattaaaaacattgacagaattat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36561706 |
ttacaaccgtgaagcaaccatgcatgatatcatatcaaggactgcattagtggtgattaaaaacattgacagaattat |
36561629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 36561831 - 36561793
Alignment:
| Q |
18 |
atttcaatcgtaactgaagattatatattgtttaccatt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36561831 |
atttcaatcgtaactgaagattatatattgtttaccatt |
36561793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University