View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16552_low_21 (Length: 238)
Name: NF16552_low_21
Description: NF16552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16552_low_21 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 2368748 - 2368968
Alignment:
| Q |
18 |
gatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggatctggtataggagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2368748 |
gatcacatcccaattttttatagagtatactatatgatcatgaatgaatttggattattaatttattgttgtataaagggcgtggatctggtataggagg |
2368847 |
T |
|
| Q |
118 |
attgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatggttatggttatggacatgggaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2368848 |
attgatcgcaggggcggcagctgcatatggtgctcaccatctgtctcatggacatggaggttaccatcatggttatggttatggttatggacatgggaag |
2368947 |
T |
|
| Q |
218 |
tataagcatggcaaatttggc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2368948 |
tataagcatggcaaatttggc |
2368968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 195
Target Start/End: Original strand, 2365416 - 2365506
Alignment:
| Q |
105 |
ctggtataggaggattgatcgcaggggcggcagctgcatacggtgctcaccatctgtcttatggacatggaggttatcatcatggttatgg |
195 |
Q |
| |
|
|||||||||||||| || | ||||| | || |||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2365416 |
ctggtataggaggactgtttgcaggaggggtggctgcatacggttctcaccatctgtcacatggacatggaggttatcatcatggtcatgg |
2365506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University