View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16553_high_2 (Length: 340)
Name: NF16553_high_2
Description: NF16553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16553_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 6 - 323
Target Start/End: Original strand, 44310094 - 44310408
Alignment:
| Q |
6 |
tgttcagctataggaaacctataacatcaaagcatggcaatcaaaattcaatctattattaataaactaaaagtttatattttgtgtaggaatatgatac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310094 |
tgttcagctataggaaacctataacatcaaagcatggcaatcaaaattcaatctattattaataaactaaaagtttatattttgtgtaggaatatgatac |
44310193 |
T |
 |
| Q |
106 |
ttggacttgaattggtagatttctgagtggggtannnnnnnnncctccataagatgtctgaattgcgagaagaagcaacaaacatcaccttggtaggaaa |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310194 |
ttggacttgaattggtcgatttctgagtggggtatttttttttcctccataagatgtctgaattgcgagaagaagcaacaaacatcaccttggtaggaaa |
44310293 |
T |
 |
| Q |
206 |
atatccaaccttgtcttgaaactcggttaacttgcttccattatttatttatttattttgactaagagaagtagaattcttcataaacatggttgcataa |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310294 |
atatccaaccttgtcttgaaactcggttaacttgcttcc---atttatttatttattttgactaagagaagtagaattcttcataaacatggttgcataa |
44310390 |
T |
 |
| Q |
306 |
tctatcaatgtggagact |
323 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
44310391 |
tctatcaatatggagact |
44310408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University