View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16553_low_8 (Length: 250)
Name: NF16553_low_8
Description: NF16553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16553_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 93 - 231
Target Start/End: Complemental strand, 44309539 - 44309401
Alignment:
| Q |
93 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44309539 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
44309440 |
T |
|
| Q |
193 |
acgcaaaatgcatatctattaatgacgaaaaatgttgca |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44309439 |
acgcaaaatgtatatctattaatgacgaaaaatgttgca |
44309401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 44310073 - 44309978
Alignment:
| Q |
1 |
tatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggaccttttt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310073 |
tatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggaccttttt |
44309978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 51 - 242
Target Start/End: Complemental strand, 18701354 - 18701147
Alignment:
| Q |
51 |
caagacaaggtttttggaaagctattatgagaagttggacctttttgtt----------------gaaattcattttaactcaaccctcctcttcaaaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701354 |
caagacaaggtttttggaaagctattatgagaagttggacctttttattttatttactgtctattgaaattcattttaactcaaccctcctcttcaaaca |
18701255 |
T |
|
| Q |
135 |
tatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatgacgcaaaatgcatatctattaatgacgaaaaatgttgcaggg |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18701254 |
tatctgcaaccaatttttacttatccaacgcaacatcaaaaagtctactaaattgatgacacaaaatgtatatctattaatgacgaaaaatgttccaggg |
18701155 |
T |
|
| Q |
235 |
cctttgct |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
18701154 |
cctttgct |
18701147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University