View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16553_low_9 (Length: 237)
Name: NF16553_low_9
Description: NF16553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16553_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25323893 - 25323674
Alignment:
| Q |
1 |
aaatggaatcttaatctttgtcatacaatggtaatagttggaattaagattgaaatatatattggatttccggtgttgtgaaaggttgagggtgcagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25323893 |
aaatggaatcttaatctttgtcatacaatggtaatagttggaattaagattgaaatatatattggattttcggtgttgtgaaaggttgagggtgcagcaa |
25323794 |
T |
|
| Q |
101 |
atcaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggtattgttctctgcttacatatacaaagcatcttaattttcaataa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25323793 |
ataaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggtattgttatctgctcacatatacaaagcatcttaattttcaataa |
25323694 |
T |
|
| Q |
201 |
agaattttttatactactttt |
221 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
25323693 |
agaat-ttttatactactttt |
25323674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 79 - 161
Target Start/End: Complemental strand, 25329981 - 25329899
Alignment:
| Q |
79 |
tgaaaggttgagggtgcagcaaatcaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggtattgt |
161 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||||||| |||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
25329981 |
tgaaagtttgaaggtgcagcaaatgaagatggcaggaaaccaagcatatgggatacctttgcccatggtggaaatggtattgt |
25329899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 161
Target Start/End: Original strand, 9988872 - 9988952
Alignment:
| Q |
81 |
aaaggttgagggtgcagcaaatcaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggtattgt |
161 |
Q |
| |
|
|||| |||| |||||| ||||| |||| || ||||| |||||||| ||||||||||| ||| || ||||||||||||||| |
|
|
| T |
9988872 |
aaagtttgaaggtgcatcaaatgaagacggtaggaaaccaagcatatgggatacctttgcccgtggtggaaatggtattgt |
9988952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 81 - 161
Target Start/End: Original strand, 14331905 - 14331985
Alignment:
| Q |
81 |
aaaggttgagggtgcagcaaatcaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggtattgt |
161 |
Q |
| |
|
|||| |||| |||||||||||| ||||||| ||||| |||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
14331905 |
aaagtttgaaggtgcagcaaatgaagatggtaggaaaccaagcatatgggatacctttgcccatggtggaaatggtattgt |
14331985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 157
Target Start/End: Complemental strand, 5220955 - 5220877
Alignment:
| Q |
79 |
tgaaaggttgagggtgcagcaaatcaagatggcaggaagccaagcatttgggataccttctcccatgctggaaatggta |
157 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||| ||||||| ||||||||||| | |||||||| ||||||| |
|
|
| T |
5220955 |
tgaaaggtagaaggtgcagcaaatgaagatggcaggaaggcaagcatatgggatacctttgcacatgctggcaatggta |
5220877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University