View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_105 (Length: 236)
Name: NF16554_high_105
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_105 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 220
Target Start/End: Original strand, 30183750 - 30183967
Alignment:
| Q |
3 |
gggagcaaatatattggtaatgtaatgtaatgaattaataatttcaaacaaaagacagttacggactgggattactttttaattaatggaaaatgtgggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183750 |
gggagcaaatatattggtaatgtaatgtaatgaattaataatttcaaacaaaagacagttacggactgggattactttttaattaatggaaaatgtgggt |
30183849 |
T |
 |
| Q |
103 |
cagaaaacaagtcattgagttcacttatctcttggttgcagttttaggtacaagagactctaccatggaaccaacttgtgctgcttgtgccatggaatgg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30183850 |
cagaaaacaagtcattgagttcacttatctcttggttgcagttttaggtacaagagactctaccatggaaccaacttgtgctgcttgtgccatggaatgg |
30183949 |
T |
 |
| Q |
203 |
agcatccaacttgagaag |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30183950 |
agcatccaacttgagaag |
30183967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University