View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_110 (Length: 226)
Name: NF16554_high_110
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_110 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 31458407 - 31458220
Alignment:
| Q |
16 |
gcaaaggtagatagaactgtacttatttattccttnnnnnnnnnnnnnngaactgtacttatttatgaatttatgaccatgaaaatattgatggaaatgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31458407 |
gcaaaggtagatagaactgtacttatttattccttcaaaaaaaaaa---gaactgtacttatttatgaatttatgaccatgaaaatattgatgggaatgc |
31458311 |
T |
 |
| Q |
116 |
ttacttgggaccatgttgactggcataccaaacgagtcctttatgaacaattgagatggcattttgcagagattaatacacatcccaacac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31458310 |
ttacttgggaccatgttgactggcataccaaacgagtcctttatgaacaattgagatggcattttgcagagattaatacacatcccaacac |
31458220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University