View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_113 (Length: 213)
Name: NF16554_high_113
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_113 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 81 - 198
Target Start/End: Original strand, 42087926 - 42088043
Alignment:
| Q |
81 |
ggatttgagagtggaatagagggacggcatcggtgatttcaacggtgtcgttggaggaggagatgcggccgatcaagacgccgttgacggcggatgtagg |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087926 |
ggatttgagagtggaaaagagggacggcatcggtgatttcaacggtgtcgttggaggaggagatgcggccgatcaagacgccgttgacggcggatgtagg |
42088025 |
T |
 |
| Q |
181 |
gtgtttgagagagtgaag |
198 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42088026 |
gtgtttgagagagtgaag |
42088043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University