View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_116 (Length: 208)
Name: NF16554_high_116
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_116 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 14 - 98
Target Start/End: Complemental strand, 47759503 - 47759418
Alignment:
| Q |
14 |
gagaagaacactagattggaaaacatgt-ttggagaatttggaaccttgctcgtcagaagaagcaggttcagtttcttcatttttt |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759503 |
gagaggaacactagattggaaaacatgtgttggagaatttggaaccttgctcgtcagaagaagcaggttcagtttcttcatttttt |
47759418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 186
Target Start/End: Original strand, 2622265 - 2622349
Alignment:
| Q |
105 |
gtagcaatttcctgcatttggctaccagtatgtatcttag---attctaacactttattttttcattaatcacatatatagttgc |
186 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| ||||||||| | ||| | |||||||||||||||||||||||| |
|
|
| T |
2622265 |
gtagcgatttcctgcatttggctaccggtatgtatcttgttgaattctaacattgtatctgttcattaatcacatatatagttgc |
2622349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 9325336 - 9325388
Alignment:
| Q |
103 |
tagtagcaatttcctgcatttggctaccagtatgtatcttagattctaacact |
155 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
9325336 |
tagtagtaattttctgcatttggctaccattatgtttcttagattctaacact |
9325388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University