View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_28 (Length: 481)
Name: NF16554_high_28
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 269 - 471
Target Start/End: Complemental strand, 28789976 - 28789776
Alignment:
| Q |
269 |
ttactcttcctctactctcttctttttcttctgcacccnnnnnnnnnctcttccactggtttccataaagattgagtctttttcttctctaccaaccatt |
368 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28789976 |
ttactcttgctctactctcttctttttcttctgcacccttttttt--ctcttccactggtttccataaagattgagtccctttcttctctaccaaccatt |
28789879 |
T |
|
| Q |
369 |
tttgcatgccttgttttgttatcttgcattggttcttgataatatcgatgcttcttttccatgttgtgacttcctattctaaccaactttaccagttcct |
468 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28789878 |
tttgtatgccttgttttgttatcttgcattggttcttgataatatcgatgcttcttttccatgttgtgacttcctattctaaccaactttaccagttcct |
28789779 |
T |
|
| Q |
469 |
ttg |
471 |
Q |
| |
|
||| |
|
|
| T |
28789778 |
ttg |
28789776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 26 - 188
Target Start/End: Complemental strand, 28790215 - 28790051
Alignment:
| Q |
26 |
ctccaatattaaatcattaatcaatatatata--acattggttgttttgagtgtgattcttggttttatatagcagcacaaaacacaagcttctattcta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790215 |
ctccaatattaaatcattaatcaatatatatataacattggttgttttgagtgtgattcttggttttatatagcagcacaaaacacaagcttctattcta |
28790116 |
T |
|
| Q |
124 |
tttcagcacgcttgctttatggttaagctttcttactgaagaattttgcatagtttgaaatggaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790115 |
tttcagcacgcttgctttatggttaagctttcttactgaagaattttgcatagtttgaaatggaa |
28790051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University