View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_35 (Length: 443)
Name: NF16554_high_35
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 16 - 427
Target Start/End: Complemental strand, 32052383 - 32051971
Alignment:
| Q |
16 |
atcaacatagtaaaacgacaagacaacattacattatttcactcccaaagtatagaactaggtgccacatcttgccattattatttccaattgccaccac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052383 |
atcaacatagtaaaacgacaagacaacattacattatttcactcccaaagtatagaactaggtgccacatcttgccattattatttccaattgccaccac |
32052284 |
T |
|
| Q |
116 |
aaccatgaaagcttcattacgcagtgctactccacttgctctaatttcacctaaccaactactcaatgcatccactcctggtaattataactcatctact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052283 |
aaccatgaaagcttcattacgcagtgctactccacttgctctaatttcacctaaccaactactcaatgcatccactcctggtaattataactcatctact |
32052184 |
T |
|
| Q |
216 |
ttgtctagatgcttattttcactttcttgaattcaaaactgtttttctttgttaaattcatcaacataagtag-nnnnnnnnnnnnnnaaccctcggatt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32052183 |
ttgtctagatgcttattttcactttcttgaattcaaaactgtttttctttgttaaattcatcaacataagtagtttttaattttttttaaccctcggatt |
32052084 |
T |
|
| Q |
315 |
atgggaaagacctctggtaattcaaaatttgagtgagaattaattaaaatttatttaaggaacgtttcatcttagaatataggttgagtttagctcaacc |
414 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
32052083 |
atggaaaagatctctggtaattcaaaatttgatcgagaattaattaaaatttatttaaggaacgtttcatcttagaatttagattgagtttagctcaacc |
32051984 |
T |
|
| Q |
415 |
atacaaaattagt |
427 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
32051983 |
atgcaaaactagt |
32051971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University