View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_67 (Length: 332)
Name: NF16554_high_67
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 172 - 320
Target Start/End: Complemental strand, 43328588 - 43328442
Alignment:
| Q |
172 |
gcgattatgatatcatggtttcaatgttactcgttcatactatattcaaagttgttttatgattgtggaactaatatgatggtcaacaacaaccttcata |
271 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
43328588 |
gcgattatgata--atggtttcaacgttactcattcatactatattcaaagttgttttgtgattgtggaactaatatgatagtcaataacgaccttcata |
43328491 |
T |
|
| Q |
272 |
taagtagtcccacgtcaatttatacttcagatcttattgtcccgtcttc |
320 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43328490 |
taagtagtctcacgtcaatttatacttcagatcttattgtcccgtcttc |
43328442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 43328702 - 43328631
Alignment:
| Q |
58 |
agaataaagatgtgagataagtaccaaaggcaatcaacaacattttgtgtcacatcgtgaatttggagatca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43328702 |
agaataaagatgtgagataagtaccaaaggcaatcaacaacattttgtgtcacattgtgaatttggagatca |
43328631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 21 - 63
Target Start/End: Complemental strand, 43328932 - 43328890
Alignment:
| Q |
21 |
atgtcctgtgaattccaactttttgtcaaaacgaacaagaata |
63 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43328932 |
atgtcctgtgaattccaactttttgtcaatacgaacaagaata |
43328890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 27 - 70
Target Start/End: Complemental strand, 25781389 - 25781346
Alignment:
| Q |
27 |
tgtgaattccaactttttgtcaaaacgaacaagaataaagatgt |
70 |
Q |
| |
|
||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
25781389 |
tgtgaattcgaactctttgtcaaaaccaacaagaataaagatgt |
25781346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University