View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_8 (Length: 649)
Name: NF16554_high_8
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 1e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 344 - 504
Target Start/End: Complemental strand, 42708927 - 42708768
Alignment:
| Q |
344 |
ggtgggttcatgttattgtaggactatacagtgtagtgtgggggaaaaacagagcaaacacagaaggcattgcatgcaaccctattggaataatgatgac |
443 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42708927 |
ggtgggttcatgttattgtaggactgtacagtgtagtgtggggaaaaaacagagcaaacacagaaggcattgcatgcaacgctattggaataatgatgac |
42708828 |
T |
|
| Q |
444 |
tcttttttgtagtcgctttgtaataaacgagttacattcacttcagatacattctcttatc |
504 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42708827 |
tct-ttttgtagtcgctttgtaataaacgagttacattcacttcagatacattctcttatc |
42708768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 523 - 638
Target Start/End: Complemental strand, 42708738 - 42708623
Alignment:
| Q |
523 |
gacaaatcttatcttgaatttttctttctcttgaattaagtatcgctttgtaataaccaatttttcttttatctttattatatcttacgacaataataaa |
622 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42708738 |
gacaaatcttatcttgaatttttctttctcttgaattaagtatcactttgtaataaccaatttttcttttatctttattatatcttacgacaataataaa |
42708639 |
T |
|
| Q |
623 |
gattaggatatttcat |
638 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42708638 |
gattaggatatttcat |
42708623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 15 - 95
Target Start/End: Complemental strand, 42709123 - 42709043
Alignment:
| Q |
15 |
caatcttctcctctataattctcttatcttggaaggtaattctatctactgattaattaataaatttcgaaacatctatct |
95 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42709123 |
caatcttctcctctataattctcttaccttggaaggtaattctatctactgattaattaataaatttcgaaacatctatct |
42709043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 7e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 438 - 504
Target Start/End: Complemental strand, 22210381 - 22210316
Alignment:
| Q |
438 |
gatgactcttttttgtagtcgctttgtaataaacgagttacattcacttcagatacattctcttatc |
504 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
22210381 |
gatgactcttttt-gtagtcgctttgtaataaacgagttacattgacttcagttacattctcttatc |
22210316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 529 - 571
Target Start/End: Complemental strand, 22210322 - 22210280
Alignment:
| Q |
529 |
tcttatcttgaatttttctttctcttgaattaagtatcgcttt |
571 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22210322 |
tcttatcttgaatttttctttctcttgaattaagtatcgcttt |
22210280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University