View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_high_98 (Length: 244)
Name: NF16554_high_98
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_high_98 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 33802478 - 33802716
Alignment:
| Q |
1 |
attcaaattagttagttcaatttttaaacaaacaatgtataagtactagcaaacaatgtaaaaatttggcttgaattgaaatattnnnnnnnccgattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33802478 |
attcaaattagttagttcaatttttaaacaaacaatatataagtactagcaaacaatgtaaaaatttggcttgaattgaaatattaaaaaaaccgattaa |
33802577 |
T |
 |
| Q |
101 |
tttataaatattaggcttatttttcattactaatctcatttttagctcaattttgcaaatgtggcatattcacttaattcatttttgccaatgtgggcat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33802578 |
tttataaatattaggcttacttttcattactaatctcatttttagctcaattttgcaaatgtggcatattcacttagttcatttttgccaatgtgggcat |
33802677 |
T |
 |
| Q |
201 |
attcattaacggtataatagactttagtatccttttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33802678 |
attcattaacggtataatagactttagtagccttttctt |
33802716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University