View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_103 (Length: 246)
Name: NF16554_low_103
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_103 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 236
Target Start/End: Complemental strand, 6713877 - 6713649
Alignment:
| Q |
6 |
tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatctcatggttcttgattttagttgcatcgtttttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6713877 |
tgttgattgtgcccctatgttttgatgattcctcgggcctttagcaggatattgagtttgttgaatc--atggttcttgattttagttgcatcgtttttg |
6713780 |
T |
|
| Q |
106 |
cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactcnnnnnnncatagacatgtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
6713779 |
cttttccttttgacattgcattggatatatgtatctcttgtactcaatttctttctatatatatgatttgatttgccactcaaaaaaacatacacatgtg |
6713680 |
T |
|
| Q |
206 |
tctgggtggttttgtggctttttagcctttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6713679 |
tctgggtggttttgtggctttttagcctttg |
6713649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University