View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_107 (Length: 242)
Name: NF16554_low_107
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 35950819 - 35951046
Alignment:
| Q |
1 |
taccaggaatcaacttgctttcatatgttatgaccctgtcctacaaaatgtccaccattgaattattttcaattttcttacaaattttgtgatatctcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35950819 |
taccaggaatcaacttgctttcatatgttatgaccctgtcctacaaaatgtccaccattgaattattttcagttttcttacaaattttgtgatatctcat |
35950918 |
T |
|
| Q |
101 |
gaattccagtgnnnnnnnntgatgcttttatatgttaaattttgcttgaataatattacacgatgttgtgaggcaattgcatgatatagatttgcttgaa |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35950919 |
gaattccagtgaaaaaaaatgatgcttttatatgttaaattttgcttgaatattattacacgatgtcgtgaggcaattgcatgatatagatttgcttgaa |
35951018 |
T |
|
| Q |
201 |
ttgaactgcatttcatgggagatcatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35951019 |
ttgaactgcatttcatgggagatcatat |
35951046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University