View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_115 (Length: 230)
Name: NF16554_low_115
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 67 - 206
Target Start/End: Original strand, 3013571 - 3013710
Alignment:
| Q |
67 |
tcatatttgttacgttattagctgatgtaggtagataacttgtcaaataagtcactctctggggtgagagatttgtaaatctattacagtcctatccgtc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3013571 |
tcatatttgttacgttattagctgatgtaggtagataacttgtcaaataagtcactctcttgggtgagagatttgtaaatctattacagtcctatccgtc |
3013670 |
T |
|
| Q |
167 |
ccagcccggttcacacaagaagaaataaataagttaaaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3013671 |
ccagcccggttcacacaagaagaaataaataagttaaaca |
3013710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University