View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_116 (Length: 230)
Name: NF16554_low_116
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_116 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 24 - 213
Target Start/End: Complemental strand, 7156188 - 7155999
Alignment:
| Q |
24 |
gtgttccttacatgggagatgctgacatacaagctcgtaatttttgtccatattacaaagccctttatgtttccaacgatgaccaactgttgctggggaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156188 |
gtgttccttacatgggagatgctgacataccagctcgtaatttttgtccatattacaaagccctttatgtttccaacgatgaccaactgttgctggggaa |
7156089 |
T |
 |
| Q |
124 |
cgtgcacgaattggttgtttacaattcgacagatggtacttttaaggctttgggaattcaaacgatcaacggccggttgtgtccagaagt |
213 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7156088 |
cgtgcacgagttggttgtttacaattcaacagatggtacttttaaggctttgggaattcaaacgatcaacggccggtggtgtccagaagt |
7155999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University