View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_121 (Length: 220)
Name: NF16554_low_121
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_121 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45700181 - 45700398
Alignment:
| Q |
1 |
tctgttccatttcctgctgtatggaaatttttacttgcagtgtcatatagccataggaggaggtactaggaagatatgtaatctgaaccaactattatga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45700181 |
tctgttccatttcctgttgtatggaaatttttacttgcagtgtcatatagccataggaggaggtactaggaagatatgtaatctgaaccaactattatga |
45700280 |
T |
 |
| Q |
101 |
aactctgattccaactcgttttagataggcatttattgacgataattaccatcaaattttacaaatatacaaataaaatgttggtcctttgggatagaag |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45700281 |
aactctgattctaactcgttttagataggcatttattgacgataattaccatcaaattttaaaaatatacaaat-aaatgttggtcctttgggatagaag |
45700379 |
T |
 |
| Q |
201 |
tcatgaaattccctggaaa |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45700380 |
ccatgaaattccctggaaa |
45700398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University