View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_121 (Length: 220)

Name: NF16554_low_121
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_121
NF16554_low_121
[»] chr1 (1 HSPs)
chr1 (1-219)||(45700181-45700398)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45700181 - 45700398
Alignment:
1 tctgttccatttcctgctgtatggaaatttttacttgcagtgtcatatagccataggaggaggtactaggaagatatgtaatctgaaccaactattatga 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45700181 tctgttccatttcctgttgtatggaaatttttacttgcagtgtcatatagccataggaggaggtactaggaagatatgtaatctgaaccaactattatga 45700280  T
101 aactctgattccaactcgttttagataggcatttattgacgataattaccatcaaattttacaaatatacaaataaaatgttggtcctttgggatagaag 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||    
45700281 aactctgattctaactcgttttagataggcatttattgacgataattaccatcaaattttaaaaatatacaaat-aaatgttggtcctttgggatagaag 45700379  T
201 tcatgaaattccctggaaa 219  Q
     ||||||||||||||||||    
45700380 ccatgaaattccctggaaa 45700398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University