View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_128 (Length: 202)
Name: NF16554_low_128
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_128 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 33801917 - 33802087
Alignment:
| Q |
14 |
catcaacaacaatcttacaactgttcaataaataatttctttcaacttgaaagatatgggttagtttagagaggtgtggtttttagaaaaatcattggtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33801917 |
catcaacaacaatcttacaactgttcaataaataatttctttcaacttgaaagatatgggttagtttagagaggtgtggtttttag-aaaatcattggtg |
33802015 |
T |
 |
| Q |
114 |
aagaggtaatggtcgctctcataattattttagaagttatttgacttaatttcttagtttcaaatttgtcat |
185 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33802016 |
aagaggtaatggtcgctcccataattattttagaagttatttgacttaatttcttagtttcaaatttgtcat |
33802087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University