View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_33 (Length: 475)
Name: NF16554_low_33
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 5947771 - 5948037
Alignment:
| Q |
1 |
tatatcgtgaaaatgtgacatgtattttgagatggatggattatatgattaatcattgttttaat--------aagaggtatccatgtttaatgtcgaat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
5947771 |
tatatcgtgaaaatgtgacatgtattttaaaatggatggattatatgattaatcattgttttaatcccgctataagagatatccatgtttagtgtcgaat |
5947870 |
T |
 |
| Q |
93 |
tcaccttgaataaacacaattttcacctgtgaaggaaatctataaagaaatcattttcattaaagagataaaattcttttacctttttcaa-ttatgtgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
5947871 |
tcaccttgaataaacacaattttcacctgtgaaggaaatctataaagaaatcattttcattaaagagataaaattcttttacctttttcaatttatttgt |
5947970 |
T |
 |
| Q |
192 |
aaatcatatgagttgttttcaaacataatatcatttacatgcaattgccaagattaattctgagttg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5947971 |
aaatcatatgagttgttttcaaacataatatcatttacatgtaattgccaagattaattctgagttg |
5948037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 408 - 471
Target Start/End: Original strand, 5948118 - 5948180
Alignment:
| Q |
408 |
tgttttgttattcctattgattcttttgcttttatattgaatttattgatgtgatgatgtccat |
471 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5948118 |
tgttttgttattc-tattgattcttttgcttttatattgaatttattgatgttatgatgtccat |
5948180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 280 - 309
Target Start/End: Original strand, 5948066 - 5948095
Alignment:
| Q |
280 |
tctttgagtcttgtaaggttcaagtgacaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5948066 |
tctttgagtcttgtaaggttcaagtgacaa |
5948095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University