View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_65 (Length: 349)
Name: NF16554_low_65
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 3 - 332
Target Start/End: Original strand, 53661838 - 53662167
Alignment:
| Q |
3 |
atccaaactctcttgcttcaggactttgatggctaaatcttgattacataatgtacctttgtacctgtgtcagctatcagtaattcaacatatacttacc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661838 |
atccaaactctcttgcttcaggactttgatagctaaatcttgattacataatgtacctttgtacctgtgtcagctatcagtaattcaacatatacttacc |
53661937 |
T |
 |
| Q |
103 |
cacaaacatatcaaagagatgaaatgatactactcacaaatcactgaacggtccagatgcaattttcttttcaaatctcaaccaacttgcttcacttgtt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661938 |
cacaaacatatcaaagagatgaaatgatactactcacaaatcactgaacggtccagatgcaattttcttttcaaatctcaaccaacttgcttcacttgtt |
53662037 |
T |
 |
| Q |
203 |
gagacgccattttcacgggtgggaaaaattacatgtctagatataaagttcatcctaattttctcttgctctgcaagctttgcaagaggaggactgccat |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53662038 |
gagacgccgttttcacgggtgggaaaaattacatgtctagatataaagttcatcctaattttctcttgctctgcaagctttgcaagaggaggactgccat |
53662137 |
T |
 |
| Q |
303 |
tttctttcaactgagactgcttctggattc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53662138 |
tttctttcaactgagactgcttctggattc |
53662167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University