View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16554_low_73 (Length: 332)

Name: NF16554_low_73
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16554_low_73
NF16554_low_73
[»] chr8 (3 HSPs)
chr8 (172-320)||(43328442-43328588)
chr8 (58-129)||(43328631-43328702)
chr8 (21-63)||(43328890-43328932)
[»] chr4 (1 HSPs)
chr4 (27-70)||(25781346-25781389)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 172 - 320
Target Start/End: Complemental strand, 43328588 - 43328442
Alignment:
172 gcgattatgatatcatggtttcaatgttactcgttcatactatattcaaagttgttttatgattgtggaactaatatgatggtcaacaacaaccttcata 271  Q
    ||||||||||||  |||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| |||||||||    
43328588 gcgattatgata--atggtttcaacgttactcattcatactatattcaaagttgttttgtgattgtggaactaatatgatagtcaataacgaccttcata 43328491  T
272 taagtagtcccacgtcaatttatacttcagatcttattgtcccgtcttc 320  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||    
43328490 taagtagtctcacgtcaatttatacttcagatcttattgtcccgtcttc 43328442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 43328702 - 43328631
Alignment:
58 agaataaagatgtgagataagtaccaaaggcaatcaacaacattttgtgtcacatcgtgaatttggagatca 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
43328702 agaataaagatgtgagataagtaccaaaggcaatcaacaacattttgtgtcacattgtgaatttggagatca 43328631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 21 - 63
Target Start/End: Complemental strand, 43328932 - 43328890
Alignment:
21 atgtcctgtgaattccaactttttgtcaaaacgaacaagaata 63  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
43328932 atgtcctgtgaattccaactttttgtcaatacgaacaagaata 43328890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 27 - 70
Target Start/End: Complemental strand, 25781389 - 25781346
Alignment:
27 tgtgaattccaactttttgtcaaaacgaacaagaataaagatgt 70  Q
    ||||||||| |||| ||||||||||| |||||||||||||||||    
25781389 tgtgaattcgaactctttgtcaaaaccaacaagaataaagatgt 25781346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University