View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_77 (Length: 318)
Name: NF16554_low_77
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 123 - 299
Target Start/End: Complemental strand, 37529956 - 37529780
Alignment:
| Q |
123 |
aaaagttattacaaagcaaaacctctgcataatatccacccctcacttcaaaattatttcatcttcttattaacaaattaaaatgaaatcaaaaaatgtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529956 |
aaaagttattacaaagcaaaacctctgcatagtatgcacccctcacttcaaaattatttcatcttcttattaacaaattaaaatgaaatcaaaaaatgtt |
37529857 |
T |
 |
| Q |
223 |
ttcgcagagtaaataggtccatttgcaaatcggagattgtgttaatatgtagtcctacaagtacttattgttaatgc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529856 |
ttcgcagagtaaataggtccatttgcaaatcggagattgtgttaatatgtagtcctacaagtacttattgttaatgc |
37529780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 13 - 60
Target Start/End: Complemental strand, 37530066 - 37530019
Alignment:
| Q |
13 |
ataattctatgtgattatgttgtttttgctgagctttatgtcagaagc |
60 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37530066 |
ataattcgatgtgattatgttgtttttgctgagctttatgtcagaagc |
37530019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 239
Target Start/End: Original strand, 17234037 - 17234074
Alignment:
| Q |
202 |
aaaatgaaatcaaaaaatgttttcgcagagtaaatagg |
239 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
17234037 |
aaaatgaaaacaaaaaatgttttcgcacagtaaatagg |
17234074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 209
Target Start/End: Complemental strand, 47364675 - 47364643
Alignment:
| Q |
177 |
tatttcatcttcttattaacaaattaaaatgaa |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
47364675 |
tatttcatcttcttattaacaatttaaaatgaa |
47364643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University