View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_78 (Length: 317)
Name: NF16554_low_78
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 141 - 227
Target Start/End: Complemental strand, 2361204 - 2361118
Alignment:
| Q |
141 |
ctctttttccttcaatcttccactgcctttattattgctattcatggcagtacaaagttgtctcttatttttcttgagatcatgtgt |
227 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| |||||| | | ||| |||||||||||||||||||| ||| |||| |
|
|
| T |
2361204 |
ctctttttccttcaatcttccacggcctctattattgctatccatggctgcaagaagctgtctcttatttttcttgagctcaagtgt |
2361118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 74 - 130
Target Start/End: Complemental strand, 2361304 - 2361248
Alignment:
| Q |
74 |
ttattttaggtcgaacatatattttcgaagcatcaagctcttcctttcttgtcttaa |
130 |
Q |
| |
|
|||||||| | | |||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2361304 |
ttattttatgactaacagatattttcaaagcatcaagctcttcctttcttgtcttaa |
2361248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University