View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_84 (Length: 298)
Name: NF16554_low_84
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 6 - 287
Target Start/End: Original strand, 9386189 - 9386470
Alignment:
| Q |
6 |
caagttttgtgatcctatgtttcatatggttttctgacaatttaggccagcaagtcggtagctcaagtcaatttattaatccatggccataacatgaaca |
105 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9386189 |
caagttttgtgaccctatgtttcatatggttttctgacaatttaggccagcaagtcggtagctcaagtcaatttattaatccatggccataacatgagca |
9386288 |
T |
 |
| Q |
106 |
acgtagagctttcagaaaattgtggtgaacattatgagaacgtaaacattgctgccttgctggggtttgttcccctgctatgcatcaattatttgcatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9386289 |
acgtagagctttcagaaaattgtggtgaacattatgagaacgtaaacattgctgccttgctggggtttgttcccctgctatgcatcaattatttgcatca |
9386388 |
T |
 |
| Q |
206 |
tctttcaaccatatattattcaatagtgtaagatatatctcaaaattataatgtttattaagagcttatgttgttaattcat |
287 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9386389 |
tctttcaaccatatattattcaataatgtaagatatatctcaaaattataatgtttattaagggcttatgttgttaattcat |
9386470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University