View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_91 (Length: 277)
Name: NF16554_low_91
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 39141584 - 39141845
Alignment:
| Q |
1 |
actttgtatctaaaatgataacaaatgtaagatgccttgtattattgtttacagcaactttttctttacttcatgaaagtgatgcgatttatgggttttt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141584 |
actttgtatctaatatgataacaaatgtaagatgccttgtattattgtttacagcaactttttctttacttcatgaaagtgatgcgatttatgggttttt |
39141683 |
T |
 |
| Q |
101 |
atctctgaagaaaattttgtgctccccaagacgagcgaaactactgacaggtcagtgtatttctactgatctgcttgtttgctataataatatagcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141684 |
atctctgaagaaaattttgtgctccccaagacgagcgaaactgctgacaggtcagtgtatttctactgatctgcttgtttgctataataatatagcatat |
39141783 |
T |
 |
| Q |
201 |
aaggagggatctaccattttttatgttgtcattaccaatagatgtgtgctgtgataattcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141784 |
aaggagggatctaccattttttatgttgtcattaccaatagatgtgtgctgtgataattcat |
39141845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University