View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16554_low_97 (Length: 269)
Name: NF16554_low_97
Description: NF16554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16554_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 52806542 - 52806309
Alignment:
| Q |
13 |
catagggaaaacattaaccttagcagtttcagacagaacaatttcatggctgctactagtgttaagcacagttcttctgagtttaactcagttctctttt |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806542 |
catagagaaaacattaaccttagcagtttcagacagaacaatttcatggctgctactagtgctaagcacagttcttctgagtttaactcagttctctttt |
52806443 |
T |
 |
| Q |
113 |
ctccaccaaaaagaaccgagttgatgagtacatcaggtggacttggcttgacccttcattcttccaggtgatattttgcttaatcaataacaataatata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52806442 |
ctccaccaaaaagaaccgagttgatgagtacatcaggtggacttggcttgacccttcattcttccaggtgatattttgcttaatcaataacaata--ata |
52806345 |
T |
 |
| Q |
213 |
ctaagtacatgtttggattcacagtgagttagacag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806344 |
ctaagtacatgtttggattcacagtgagttagacag |
52806309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University