View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16555_low_14 (Length: 334)
Name: NF16555_low_14
Description: NF16555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16555_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 55 - 289
Target Start/End: Original strand, 23188050 - 23188283
Alignment:
| Q |
55 |
atatgtgatgtaaatgggggaccagcatttggttccactcgatctaccttcttgtgcagctcaagagaaaattggtaggtagctagttttaagnnnnnnn |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188050 |
atatgtgatgtaaatgggggaccagcatttggttccactcgatctaccttcttgtgcagctcaagagaaaattggtaggtagctagttttaagaaaaaaa |
23188149 |
T |
 |
| Q |
155 |
ttatcggtttagataagaaggtataataattaaaacacttgcaacactatatttccactaatagttgtatttctttttagctcttagtgctccttataat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23188150 |
ttatcggtttagataagaaggtataataattaaaacacttacaacactatatttccactaatagttgtatttctttttagctcttagtgctccttataat |
23188249 |
T |
 |
| Q |
255 |
ttcaatnnnnnnntaatgtaactatttattttttc |
289 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
23188250 |
ttcaat-aaaaaataatgtaactatttattttttc |
23188283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University