View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16555_low_16 (Length: 323)
Name: NF16555_low_16
Description: NF16555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16555_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 168 - 309
Target Start/End: Original strand, 9877230 - 9877371
Alignment:
| Q |
168 |
gaatcactacctgcttatacttcttcaacctccgtccatcagcagtttcaataacaaactcagtcgagaaaatattcgtgagcttagcaccataaccgtt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877230 |
gaatcactacctgcttatacttcttcaacctccgtccatcagcagtttcaataacaaactcagtcgagaaaatattcgtgagcttagcaccataaccgtt |
9877329 |
T |
|
| Q |
268 |
tcttccaccagtagttttcttcacattatcgtcataattact |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877330 |
tcttccaccagtagttttcttcacattatcgtcataattact |
9877371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 169 - 296
Target Start/End: Original strand, 38841162 - 38841289
Alignment:
| Q |
169 |
aatcactacctgcttatacttcttcaacctccgtccatcagcagtttcaataacaaactcagtcgagaaaatattcgtgagcttagcaccataaccgttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| || | |||||||||||||| |||| |||||||| |||||||||||||||||||| ||| |
|
|
| T |
38841162 |
aatcactacctgcttatacttcttcaaacgacgtccatcaacaatctcaataacaaactccttcgaaaaaatattggtgagcttagcaccataaccattt |
38841261 |
T |
|
| Q |
269 |
cttccaccagtagttttcttcacattat |
296 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
38841262 |
ctcccaccagtagttttcttcacattat |
38841289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University