View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16555_low_19 (Length: 297)
Name: NF16555_low_19
Description: NF16555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16555_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 33 - 255
Target Start/End: Original strand, 39836545 - 39836767
Alignment:
| Q |
33 |
taactttgttcatgatcatcacaatttcaattcattgctccatcacttatgccaacacatgtatattttcctcgtcaaaccatcatatttcgttatcact |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39836545 |
taactttgttcatgatcatcacaatttcaattcattgctccatcacttatgccaacacatatatattttcctcgtcaaaccatcaaatttcgttatcact |
39836644 |
T |
|
| Q |
133 |
ccctttactagtggtccctaaaactctcattaatttgcaatttgactcatccactccatgtggtctggctcccccttactcatcact-ccccatgccatc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
39836645 |
ccctttactagtggtccctaaaactctcattaatttgcaatttgactcatccactcaatgtggtctggct-ccccttactcatcactcccccatgccatc |
39836743 |
T |
|
| Q |
232 |
tcatcattttcctataataatgga |
255 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39836744 |
tcatcattttcctataataatgga |
39836767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University