View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16555_low_29 (Length: 211)
Name: NF16555_low_29
Description: NF16555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16555_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 4532483 - 4532303
Alignment:
| Q |
12 |
attatacttgtataatgccaaatggggcaaccagatgtcgacgatgcttgagcaagaatgttgaaaaatcattgctctttataggtttgacttccaaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4532483 |
attatacttgtataatgccaaatggggcgaccagatgtcgacgatgcttgagcaagaatgttgaaaaatcattgctctttataggtttgacttccaaaaa |
4532384 |
T |
 |
| Q |
112 |
tctctatcagtttcacaacttaggacacataaaacctatgaaatgatgaatctgtgtgggagcttcactaaatgtacaatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4532383 |
tctctatcagtttcacaacttaggacaaataaaacctatggaatgatgaatctgtgtgggagcttcactaaatgtacaatt |
4532303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 59 - 132
Target Start/End: Original strand, 27998721 - 27998794
Alignment:
| Q |
59 |
ttgagcaagaatgttgaaaaatcattgctctttataggtttgacttccaaaaatctctatcagtttcacaactt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27998721 |
ttgagcaagaatgttgaaaaatcattgctctttataggtttgacttccaaaaatctctatcagtttcacaactt |
27998794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University