View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_high_28 (Length: 232)
Name: NF16557_high_28
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 4412012 - 4412235
Alignment:
| Q |
1 |
aaataagttgaggggaatgagcatattttttaagttgggtgggtnnnnnnnnnnnnnnnttcaaccgtagtgttcaatcaagccaaatcgaactaaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412012 |
aaataagttgaggggaatgagcatattttt-aagttgggtgggtaaaaaaaccaaaaaattcaaccgtagtgttcaatcaagccaaatcgaactaaactg |
4412110 |
T |
|
| Q |
101 |
aaattgctcgatttggttcagttcagatcacaatttatcagtttggtttattttgaaatagatctgttcaaatttaaaaagttctaaaattcatttgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412111 |
aaattgctcgatttggttcagttcagatcataatttatcagtttggtttattttaaaatagatcggttcaaatttaaaaagttctaaaattcatttgtgt |
4412210 |
T |
|
| Q |
201 |
ttggttatttagtatattcttcgac |
225 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
4412211 |
ttggttatttagtatatttttcgac |
4412235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University