View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_20 (Length: 355)
Name: NF16557_low_20
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 127 - 319
Target Start/End: Original strand, 35507987 - 35508179
Alignment:
| Q |
127 |
taattgggaaagaaaaccgaacccttaagaaatgggtatgagggaaatcaatggccaaatgagagaagagttggtccatgtgtttggaagcttcacacca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507987 |
taattgggaaagaaaaccgaacccttaagaaatgggtatgagggaaatcaatggccaaatgagagaagagttggtccatgtgtttggaagcttcacacca |
35508086 |
T |
 |
| Q |
227 |
tgacgcccagaagtgaagcaccgcgggagaaccgccgcgaacaacctcatccaactccgactttgacttcacgtctcgcaccgaaccccccat |
319 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35508087 |
tgacgcccagaagtgaagcaccgccggagaaccgccgcgaaccacctcatccaactccgactttgacttcacgtctcgcaccgaaccacccat |
35508179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 9 - 60
Target Start/End: Original strand, 35507869 - 35507920
Alignment:
| Q |
9 |
agcagagacagaataagcctcagatatctctggttgttcttcagcttcaacc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507869 |
agcagagacagaataagcctcagatatctctggttgttcttcagcttcaacc |
35507920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University