View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_25 (Length: 283)
Name: NF16557_low_25
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 164 - 268
Target Start/End: Complemental strand, 51937380 - 51937276
Alignment:
| Q |
164 |
acgaatccaggggtttaccgaatattgaaatggacgagcataccttcttaatcaacagagaaagagcagttgattacttgaactcccttgaaaaggtaag |
263 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937380 |
acgaatccaggggttcaccgaatattgaaatggacgagcatactttcttagtcaacagagaaagagcagttgattacttgaactcccttgaaaaggtaag |
51937281 |
T |
 |
| Q |
264 |
aaatt |
268 |
Q |
| |
|
||||| |
|
|
| T |
51937280 |
aaatt |
51937276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 51937535 - 51937457
Alignment:
| Q |
1 |
ggacgttctccacgtgacaaacgggttgttaaggatcagacaacccaacatgatctttggtggggaaagtgagtgtcct |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937535 |
ggacgttctccacgtgacaaacgggttgttaaggatcagacaacccaacatgatctttggtggggaaagtgagtgtcct |
51937457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University