View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_26 (Length: 278)
Name: NF16557_low_26
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 12016189 - 12015929
Alignment:
| Q |
1 |
agacggttaggtcatataattttcaggtgacatcatgccatacagctgaactaagcggaaatgacaaatggtaaaatgtgaagtgaagatactaatcagc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12016189 |
agacggttaggccatataattttcaggtgacatcatgccatacagctgaactgagcgggaatgacaaatggtaaaatgtgaagtgaagatgctaatcagc |
12016090 |
T |
|
| Q |
101 |
tttcaaatgtttaatcagagcaaccattactaagttggtgacaagtagaggaagaagttaaatcactgatgcactttgtatatttagaaatacagtcaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
12016089 |
tttcaaatgtttaatcagagcaaccattactaagttggtgacaagtagaggaagaagttaaatcactgatgcactttgtatgtttagaaatacagtcgca |
12015990 |
T |
|
| Q |
201 |
atgtgatcaacacttcttcttcatttgaggaaataacataaaagaaaacggagttcacaca |
261 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12015989 |
atgtgatcaacacttattcttcatttgaggaaataacataaaagaaaatggagttcacaca |
12015929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University