View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_29 (Length: 251)
Name: NF16557_low_29
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 244532 - 244763
Alignment:
| Q |
1 |
gataatctgaagttcgtctgaatcttgcatctgattatctctatcaaaattaacgtaaacttcataaataactagctatatatatggatatggtaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
244532 |
gataatctgaagttcgtctgaatcttgcatctgattatctctatcaaaattaacgtaaacttcataaatagctagc----tatatggatatggtaatgtt |
244627 |
T |
 |
| Q |
101 |
ttattaatttctcattactagggtacatattaatgtctagcaatcttgt-nnnnnnnnntatattaatgtctagcaagttcaattagtgctgtattaagt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
244628 |
ttattaatttctcattactagggtacatattaatgtctagcaatcttgtaaaaaatatatatattaatgtctagcaagttcaattagtgctgtattaagt |
244727 |
T |
 |
| Q |
200 |
tctttccatcgcatgtagtgatcatcatcaagtata |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
244728 |
tctttccatcgcatgtagtgatcatcatcaagtata |
244763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University