View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_30 (Length: 249)
Name: NF16557_low_30
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 51937533 - 51937689
Alignment:
| Q |
1 |
tcctgtctttgctcctgaaagagtggctaacgcacccgttgctgttatgaatgaacccttttcgtactttatcgcttgttcatacagctctataattaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937533 |
tcctgtctttgctcctgaaagagtggctaacgcacccgttgctgttatgaatgaacccttttcgtactttatcgcttgttcatacagctcta-------- |
51937624 |
T |
 |
| Q |
101 |
tatgtaattgaagaagtaagtatatacaaattaaaccaaaaaatattacatgcaatgatcagagattat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937625 |
----taattgaagaagtaagtatatacaaattaaaccaaaaaatattacatgcaatgatcagagattat |
51937689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 51937759 - 51937834
Alignment:
| Q |
167 |
tatcactaacatcaaatgctgttgaaataagaggactatgctggtgatgatccacgtgtgaactactccctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937759 |
tatcactaacatcaaatgctgttgaaataagaggactatgctggtgatgatccacgtgtgaactactccctttgct |
51937834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University