View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_35 (Length: 229)
Name: NF16557_low_35
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 21535899 - 21535699
Alignment:
| Q |
15 |
agtaatcttagttaaggtgtaaacaactatgtgaatttcctttatactgaaatttaccgaaatatatcaaagactcctacaattcttttttatgctattc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21535899 |
agtaatcttagttaaggtgtaaacaactatgtgaatttcctttatactgaaatttaccgaaatatatcaaagactcctacaattcttttttatgctattc |
21535800 |
T |
 |
| Q |
115 |
acgttatactttgaattcacctcgagatcatcgtggttaagctgaactcaacctatcttatgaatgacatataatcagctcagactttcctattatacac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21535799 |
acgttatactttgaattcacctcgagatcatcgtggttaagctgaactcaacctatcttatgaatgacatataatcggctcagactttcctattatacac |
21535700 |
T |
 |
| Q |
215 |
a |
215 |
Q |
| |
|
| |
|
|
| T |
21535699 |
a |
21535699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University