View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_37 (Length: 218)
Name: NF16557_low_37
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 21428035 - 21428223
Alignment:
| Q |
16 |
accacagagggagggaaaaaacagacccataagtttcaaacgtctcactgcaagatatgcaatagaaattatttcacatctttccttacttcg---ataa |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21428035 |
accacacagggagggaaaaaacagacccataagtttcaaacgtctcactgcaagacatgcaatagaaattatttcacatctttccttacttcttccataa |
21428134 |
T |
 |
| Q |
113 |
gaattgtggcttctaaaatctgtgagacttggatgtccgtaaaatcttttcttactgtcaaactgttttgactttttaactgtgattat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21428135 |
gaattgtggcttctaaaatctgtgagacttggatgtccgtaaaatcttttcttactgtcaaactgttttgactttttaactgtgattat |
21428223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University