View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16557_low_39 (Length: 210)
Name: NF16557_low_39
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16557_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 24 - 156
Target Start/End: Complemental strand, 6233819 - 6233687
Alignment:
| Q |
24 |
gttgaattgaattttatcatgatacactgtttcaaatggacctacacacatacacacattttcttcaattccaattttacccccgtatattttagtatat |
123 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233819 |
gttgaattgaattctatgatgatacactgtttcaaatggacctacacacatacacatattttcttcaattccaattttacccccgtatattttagtataa |
6233720 |
T |
|
| Q |
124 |
caaaatttccaagagtattgctgttgacacatt |
156 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| |
|
|
| T |
6233719 |
caaaatttccgagagtattgctgtcgacacatt |
6233687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University