View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16557_low_39 (Length: 210)

Name: NF16557_low_39
Description: NF16557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16557_low_39
NF16557_low_39
[»] chr2 (1 HSPs)
chr2 (24-156)||(6233687-6233819)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 24 - 156
Target Start/End: Complemental strand, 6233819 - 6233687
Alignment:
24 gttgaattgaattttatcatgatacactgtttcaaatggacctacacacatacacacattttcttcaattccaattttacccccgtatattttagtatat 123  Q
    ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||     
6233819 gttgaattgaattctatgatgatacactgtttcaaatggacctacacacatacacatattttcttcaattccaattttacccccgtatattttagtataa 6233720  T
124 caaaatttccaagagtattgctgttgacacatt 156  Q
    |||||||||| ||||||||||||| ||||||||    
6233719 caaaatttccgagagtattgctgtcgacacatt 6233687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University