View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16558_low_4 (Length: 280)
Name: NF16558_low_4
Description: NF16558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16558_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 35128891 - 35129145
Alignment:
| Q |
14 |
agatgaaccaattggtgatttgcggatagaaatgcaggttattaatatattgtcagctgaggactggcctgaggttactgatgacaaaattcatacagat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35128891 |
agatgaaccaattggtgatttgcggatagaaatgcaggttattaatatattgtcagctgaggactcgcctgaggttactgatgacaaaattcatacagat |
35128990 |
T |
|
| Q |
114 |
gaaaatgttgaggaggaacttgagcctattatcctgcagaaaggggagttggatgatatttctgaccttgtgaatcaagaaatgcagttgcatgaatata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35128991 |
gaaaatgttgaggaggaacttgagcctattatcctgcagaaaggggagttggatgatatttctgaccttgtgaatcaagaaatgcagttgcatggatata |
35129090 |
T |
|
| Q |
214 |
ataaaataatggactcattagatgcagatgctacagaaattgctgatgaaagtga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35129091 |
ataaaataatggactcattagatgcagatgctacagaaattgctgatgaaagtga |
35129145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 121
Target Start/End: Original strand, 35128536 - 35128644
Alignment:
| Q |
13 |
gagatgaaccaattggtgatttgcggatagaaatgcaggttattaatatattgtcagctgaggactggcctgaggttactgatgacaaaattcatacaga |
112 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| | |||| | ||||||||| ||||||||||| | |||||||||| ||||||||||| ||||| | |
|
|
| T |
35128536 |
gagatgaaccaattggcgatttgatgatagaaacaccggttctcaatatattggtagctgaggacttgtctgaggttaccaatgacaaaattgatacaaa |
35128635 |
T |
|
| Q |
113 |
tgaaaatgt |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
35128636 |
tgaaaatgt |
35128644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University